Installation¶

To install NA_Thermo, simply:

• Download the zip or tar file of the repository and unpack; or:

git clone https://github.com/ribokit/Primerize.git

• In MATLAB, go to "Set Path". Then "Add with Subfolders" of the target path/to/Primerize/MATLAB/Scripts/.

Usage¶

To design primers for your sequence, just follow these easy steps:

1. Define your sequence. For example:

sequence = 'TTCTAATACGACTCACTATAGGCCAAAACAACGGAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCAAAACCAAACCAAAGAAACAACAACAACAAC';
tag = 'P4P6';

This sequences includes a 20-nucleotide T7 promoter sequence at the beginning, and then a construct (starting with GG...) encoding the P4-P6 domain of the Tetrahymena ribozyme along with flanking sequences.

2. Run with:

primers = design_primers(sequence, tag);

This will compute primers with minimal length, annealing temperatures above a cutoff (60 C, by default), through a recursive strategy. An additional score term helps avoid primers that share multiple 3' nucleotides with other parts of the sequence, as a heuristic to reduce mispriming. The algorithm has similarities (but was developed independently) of Thachuk & Condon (2007), BIBE, Proc. of 7th IEEE International Conf., p. 123-130.

If you want to use our original script (in use from 2008-2011), use design_primers_OLD(). (This was slower and did not rigorously optimize length.)

3. We usually copy/paste these to a Word or Excel document for easy look-up later. If you add primer labels, you can copy/paste these to the IDT website or wherever.